Review





Similar Products

93
Developmental Studies Hybridoma Bank anti mouse lamp2
( A ) Confocal microscopy of endogenous BMP (yellow) and <t>LAMP2</t> (magenta) immunofluorescence in wild-type (WT) and R1441G LRRK2 MEFs. Scale bar: 20 µm. Quantification of vesicular BMP intensity ( B ) and LAMP2 relative intensity ( C ) per cell area. Colored dots represent mean value from four independent experiments, and violin plots show the distribution of individual cell data. Significance determined by two-tailed paired t -test **p < 0.01, ***p < 0.001. ( D ) Representative transmission electron microscopy (TEM) images of multivesicular endosomes (MVE) from WT and R1441G LRRK2 MEFs. MVB periphery highlighted in yellow. Scale bar: 250 nm. ( E ) MVE area (µm 2 ) quantification in WT and R1441G LRRK2 mutant cells. Colored dots represent mean values from 3 independent experiments and violin plots show the distribution of individual cell data (35–45 cells/group). ( F ) Quantification of intraluminal vesicles (ILVs) per MVE in WT and R1441G LRRK2 MEF cells. The number of ILVs per MVE is binned in three groups and plotted as a percentage of MVE from the total population of each experiment independently. Data from 3 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test ( E ) and ordinary two-way ANOVA, uncorrected Fisher’s LSD ( F ). *p < 0.05, ****p < 0.0001. Figure 1—source data 1. IF images in panel A. Figure 1—source data 2. TEM images in panel D. Figure 1—source data 3. Plotted values in panels B, C, E, F.
Anti Mouse Lamp2, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+lamp2/pmc13046380-3-2-9?v=Developmental+Studies+Hybridoma+Bank
Average 93 stars, based on 1 article reviews
anti mouse lamp2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Developmental Studies Hybridoma Bank mouse anti lamp2
( A ) Confocal microscopy of endogenous BMP (yellow) and <t>LAMP2</t> (magenta) immunofluorescence in wild-type (WT) and R1441G LRRK2 MEFs. Scale bar: 20 µm. Quantification of vesicular BMP intensity ( B ) and LAMP2 relative intensity ( C ) per cell area. Colored dots represent mean value from four independent experiments, and violin plots show the distribution of individual cell data. Significance determined by two-tailed paired t -test **p < 0.01, ***p < 0.001. ( D ) Representative transmission electron microscopy (TEM) images of multivesicular endosomes (MVE) from WT and R1441G LRRK2 MEFs. MVB periphery highlighted in yellow. Scale bar: 250 nm. ( E ) MVE area (µm 2 ) quantification in WT and R1441G LRRK2 mutant cells. Colored dots represent mean values from 3 independent experiments and violin plots show the distribution of individual cell data (35–45 cells/group). ( F ) Quantification of intraluminal vesicles (ILVs) per MVE in WT and R1441G LRRK2 MEF cells. The number of ILVs per MVE is binned in three groups and plotted as a percentage of MVE from the total population of each experiment independently. Data from 3 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test ( E ) and ordinary two-way ANOVA, uncorrected Fisher’s LSD ( F ). *p < 0.05, ****p < 0.0001. Figure 1—source data 1. IF images in panel A. Figure 1—source data 2. TEM images in panel D. Figure 1—source data 3. Plotted values in panels B, C, E, F.
Mouse Anti Lamp2, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+lamp2/bio_rxiv__64898__2026__03__30__714413-342-48-52?v=Developmental+Studies+Hybridoma+Bank
Average 93 stars, based on 1 article reviews
mouse anti lamp2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
OriGene qpcr primer lamp2 fw gagcaggtgctttctgtgtctag rev gcctgaaagaccagcaccaact
(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and <t>Lamp2</t> ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).
Qpcr Primer Lamp2 Fw Gagcaggtgctttctgtgtctag Rev Gcctgaaagaccagcaccaact, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+lamp2/pmc13155197-91-0-9?v=OriGene
Average 94 stars, based on 1 article reviews
qpcr primer lamp2 fw gagcaggtgctttctgtgtctag rev gcctgaaagaccagcaccaact - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

93
Developmental Studies Hybridoma Bank rat anti mouse lamp2
Mouse femur section was co-stained with anti-CtsK (green), HS20 (purple) and <t>anti-LAMP2</t> (red) and visualized with anti-rabbit Alexa488, anti-human Alexa594, and anti-rat Alexa647 secondary antibodies, respectively. Area shown is the cortical bone. The approximate boundary of the bone is shown with white dashed line. A blood vessel within the bone is indicated with yellow dashed line. Red blood cells in the vessel shown strong green autofluorescence. A closeup view of the large osteoclast is shown in the right bottom panel. Another osteoclast (likely only the tip of the osteoclast) is indicated with a yellow arrow in the merged image. Nuclei of several osteocytes are indicated with white arrow head. Images representative of three separate experiments.
Rat Anti Mouse Lamp2, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+lamp2/bio_rxiv__64898__2026__01__18__700217-144-43-47?v=Developmental+Studies+Hybridoma+Bank
Average 93 stars, based on 1 article reviews
rat anti mouse lamp2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Developmental Studies Hybridoma Bank monoclonal mouse anti lamp2
Mouse femur section was co-stained with anti-CtsK (green), HS20 (purple) and <t>anti-LAMP2</t> (red) and visualized with anti-rabbit Alexa488, anti-human Alexa594, and anti-rat Alexa647 secondary antibodies, respectively. Area shown is the cortical bone. The approximate boundary of the bone is shown with white dashed line. A blood vessel within the bone is indicated with yellow dashed line. Red blood cells in the vessel shown strong green autofluorescence. A closeup view of the large osteoclast is shown in the right bottom panel. Another osteoclast (likely only the tip of the osteoclast) is indicated with a yellow arrow in the merged image. Nuclei of several osteocytes are indicated with white arrow head. Images representative of three separate experiments.
Monoclonal Mouse Anti Lamp2, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+lamp2/pmc12886278-36-94-97?v=Developmental+Studies+Hybridoma+Bank
Average 93 stars, based on 1 article reviews
monoclonal mouse anti lamp2 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology mouse monoclonal anti lamp2 santa cruz rabbit polyclonal anti sqstm1 p62
Mouse femur section was co-stained with anti-CtsK (green), HS20 (purple) and <t>anti-LAMP2</t> (red) and visualized with anti-rabbit Alexa488, anti-human Alexa594, and anti-rat Alexa647 secondary antibodies, respectively. Area shown is the cortical bone. The approximate boundary of the bone is shown with white dashed line. A blood vessel within the bone is indicated with yellow dashed line. Red blood cells in the vessel shown strong green autofluorescence. A closeup view of the large osteoclast is shown in the right bottom panel. Another osteoclast (likely only the tip of the osteoclast) is indicated with a yellow arrow in the merged image. Nuclei of several osteocytes are indicated with white arrow head. Images representative of three separate experiments.
Mouse Monoclonal Anti Lamp2 Santa Cruz Rabbit Polyclonal Anti Sqstm1 P62, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+lamp2/pm41539523-71-17-20?v=Santa+Cruz+Biotechnology
Average 96 stars, based on 1 article reviews
mouse monoclonal anti lamp2 santa cruz rabbit polyclonal anti sqstm1 p62 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology mouse anti lamp2
Mouse femur section was co-stained with anti-CtsK (green), HS20 (purple) and <t>anti-LAMP2</t> (red) and visualized with anti-rabbit Alexa488, anti-human Alexa594, and anti-rat Alexa647 secondary antibodies, respectively. Area shown is the cortical bone. The approximate boundary of the bone is shown with white dashed line. A blood vessel within the bone is indicated with yellow dashed line. Red blood cells in the vessel shown strong green autofluorescence. A closeup view of the large osteoclast is shown in the right bottom panel. Another osteoclast (likely only the tip of the osteoclast) is indicated with a yellow arrow in the merged image. Nuclei of several osteocytes are indicated with white arrow head. Images representative of three separate experiments.
Mouse Anti Lamp2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+lamp2/pmc12719038-246-22-25?v=Santa+Cruz+Biotechnology
Average 96 stars, based on 1 article reviews
mouse anti lamp2 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


( A ) Confocal microscopy of endogenous BMP (yellow) and LAMP2 (magenta) immunofluorescence in wild-type (WT) and R1441G LRRK2 MEFs. Scale bar: 20 µm. Quantification of vesicular BMP intensity ( B ) and LAMP2 relative intensity ( C ) per cell area. Colored dots represent mean value from four independent experiments, and violin plots show the distribution of individual cell data. Significance determined by two-tailed paired t -test **p < 0.01, ***p < 0.001. ( D ) Representative transmission electron microscopy (TEM) images of multivesicular endosomes (MVE) from WT and R1441G LRRK2 MEFs. MVB periphery highlighted in yellow. Scale bar: 250 nm. ( E ) MVE area (µm 2 ) quantification in WT and R1441G LRRK2 mutant cells. Colored dots represent mean values from 3 independent experiments and violin plots show the distribution of individual cell data (35–45 cells/group). ( F ) Quantification of intraluminal vesicles (ILVs) per MVE in WT and R1441G LRRK2 MEF cells. The number of ILVs per MVE is binned in three groups and plotted as a percentage of MVE from the total population of each experiment independently. Data from 3 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test ( E ) and ordinary two-way ANOVA, uncorrected Fisher’s LSD ( F ). *p < 0.05, ****p < 0.0001. Figure 1—source data 1. IF images in panel A. Figure 1—source data 2. TEM images in panel D. Figure 1—source data 3. Plotted values in panels B, C, E, F.

Journal: eLife

Article Title: Extracellular vesicle-mediated release of bis(monoacylglycerol)phosphate is regulated by LRRK2 and glucocerebrosidase activity

doi: 10.7554/eLife.106330

Figure Lengend Snippet: ( A ) Confocal microscopy of endogenous BMP (yellow) and LAMP2 (magenta) immunofluorescence in wild-type (WT) and R1441G LRRK2 MEFs. Scale bar: 20 µm. Quantification of vesicular BMP intensity ( B ) and LAMP2 relative intensity ( C ) per cell area. Colored dots represent mean value from four independent experiments, and violin plots show the distribution of individual cell data. Significance determined by two-tailed paired t -test **p < 0.01, ***p < 0.001. ( D ) Representative transmission electron microscopy (TEM) images of multivesicular endosomes (MVE) from WT and R1441G LRRK2 MEFs. MVB periphery highlighted in yellow. Scale bar: 250 nm. ( E ) MVE area (µm 2 ) quantification in WT and R1441G LRRK2 mutant cells. Colored dots represent mean values from 3 independent experiments and violin plots show the distribution of individual cell data (35–45 cells/group). ( F ) Quantification of intraluminal vesicles (ILVs) per MVE in WT and R1441G LRRK2 MEF cells. The number of ILVs per MVE is binned in three groups and plotted as a percentage of MVE from the total population of each experiment independently. Data from 3 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test ( E ) and ordinary two-way ANOVA, uncorrected Fisher’s LSD ( F ). *p < 0.05, ****p < 0.0001. Figure 1—source data 1. IF images in panel A. Figure 1—source data 2. TEM images in panel D. Figure 1—source data 3. Plotted values in panels B, C, E, F.

Article Snippet: Antibody , anti-mouse LAMP2, clone GL2A7 (Rat monoclonal) , Developmental Studies Hybridoma Bank , GL2A7; RRID: AB_2281134 , IF (1:500) WB (1:1000).

Techniques: Confocal Microscopy, Immunofluorescence, Two Tailed Test, Transmission Assay, Electron Microscopy, Mutagenesis

( A ) Whole cell lysates (WCL) from wild-type (WT) and R1441G LRRK2 mouse embryonic fibroblast (MEF) cells treated with 200 nM MLi-2 for 24 hr were analyzed by immunoblotting. Representative images of LAMP2, phospho-Rab10, and α-Tubulin levels are shown. Molecular weight marker mobility is shown in kDa. ( B ) Flow cytometry measurement of GCase activity using PFB-FDGlu fluorescent GCase substrate in WT and R1441G LRRK2 mutant MEF cells treated with 300 µM conduritol β-epoxide (CBE) for 24 hr. WCL and isolated EVs from WT and R1441G LRRK2 mutant MEF cells treated with 200 nM MLi-2 ( C ) or 300 µM CBE ( G ) for 48 hr were analyzed by immunoblotting. Representative images of LAMP2, Flotillin-1, and α-Tubulin levels are shown. Molecular weight marker mobility is shown in kDa. Immunoblots for LAMP2 and Flotillin-1 in EV fractions required longer exposure times to visualize clear signals across all conditions. Quantification of LAMP2 and Flotillin-1 levels relative to R1441G LRRK2 MEF cells in WCL ( D , H ) and isolated EVs ( E , F , I, J ). Data from 6 to 8 independent experiments (mean ± SEM). Significance determined by Kruskal–Wallis test followed by an uncorrected Dunn’s post hoc test compared to R1441G LRRK2 control *p < 0.05, **p < 0.01, ***p < 0.001; ns, not significant. Figure 2—source data 1. Uncropped blots. Figure 2—source data 2. Annotated uncropped blots. Figure 2—source data 3. Plotted values in panels D–F, H–J.

Journal: eLife

Article Title: Extracellular vesicle-mediated release of bis(monoacylglycerol)phosphate is regulated by LRRK2 and glucocerebrosidase activity

doi: 10.7554/eLife.106330

Figure Lengend Snippet: ( A ) Whole cell lysates (WCL) from wild-type (WT) and R1441G LRRK2 mouse embryonic fibroblast (MEF) cells treated with 200 nM MLi-2 for 24 hr were analyzed by immunoblotting. Representative images of LAMP2, phospho-Rab10, and α-Tubulin levels are shown. Molecular weight marker mobility is shown in kDa. ( B ) Flow cytometry measurement of GCase activity using PFB-FDGlu fluorescent GCase substrate in WT and R1441G LRRK2 mutant MEF cells treated with 300 µM conduritol β-epoxide (CBE) for 24 hr. WCL and isolated EVs from WT and R1441G LRRK2 mutant MEF cells treated with 200 nM MLi-2 ( C ) or 300 µM CBE ( G ) for 48 hr were analyzed by immunoblotting. Representative images of LAMP2, Flotillin-1, and α-Tubulin levels are shown. Molecular weight marker mobility is shown in kDa. Immunoblots for LAMP2 and Flotillin-1 in EV fractions required longer exposure times to visualize clear signals across all conditions. Quantification of LAMP2 and Flotillin-1 levels relative to R1441G LRRK2 MEF cells in WCL ( D , H ) and isolated EVs ( E , F , I, J ). Data from 6 to 8 independent experiments (mean ± SEM). Significance determined by Kruskal–Wallis test followed by an uncorrected Dunn’s post hoc test compared to R1441G LRRK2 control *p < 0.05, **p < 0.01, ***p < 0.001; ns, not significant. Figure 2—source data 1. Uncropped blots. Figure 2—source data 2. Annotated uncropped blots. Figure 2—source data 3. Plotted values in panels D–F, H–J.

Article Snippet: Antibody , anti-mouse LAMP2, clone GL2A7 (Rat monoclonal) , Developmental Studies Hybridoma Bank , GL2A7; RRID: AB_2281134 , IF (1:500) WB (1:1000).

Techniques: Western Blot, Molecular Weight, Marker, Flow Cytometry, Activity Assay, Mutagenesis, Isolation, Control

( A–C ) No significant differences in EV release between MLi-2/conduritol β-epoxide (CBE)-treated and untreated wild-type (WT) MEF cells. Quantification of LAMP2 and Flotillin-1 levels relative to WT control MEF cells in whole cell lysates (WCL) ( A ) and isolated EVs ( B–C ). Data from 7 to 8 independent experiments (mean ± SEM). Significance determined by ordinary one-way ANOVA, uncorrected Fisher’s LSD. ( D–E ) Characterization of WT or R1441G LRRK2 MEF-derived purified EVs by nanoparticle tracking analysis (NTA). ( D ) Representative plots of EV size distribution in each indicated condition. ( E ) Yield comparison of MEF-derived EVs from each indicated condition determined by NTA. Each colored dot represents an independent experiment. Figure 2—figure supplement 1—source data 1. Plotted values in panels A–C, E.

Journal: eLife

Article Title: Extracellular vesicle-mediated release of bis(monoacylglycerol)phosphate is regulated by LRRK2 and glucocerebrosidase activity

doi: 10.7554/eLife.106330

Figure Lengend Snippet: ( A–C ) No significant differences in EV release between MLi-2/conduritol β-epoxide (CBE)-treated and untreated wild-type (WT) MEF cells. Quantification of LAMP2 and Flotillin-1 levels relative to WT control MEF cells in whole cell lysates (WCL) ( A ) and isolated EVs ( B–C ). Data from 7 to 8 independent experiments (mean ± SEM). Significance determined by ordinary one-way ANOVA, uncorrected Fisher’s LSD. ( D–E ) Characterization of WT or R1441G LRRK2 MEF-derived purified EVs by nanoparticle tracking analysis (NTA). ( D ) Representative plots of EV size distribution in each indicated condition. ( E ) Yield comparison of MEF-derived EVs from each indicated condition determined by NTA. Each colored dot represents an independent experiment. Figure 2—figure supplement 1—source data 1. Plotted values in panels A–C, E.

Article Snippet: Antibody , anti-mouse LAMP2, clone GL2A7 (Rat monoclonal) , Developmental Studies Hybridoma Bank , GL2A7; RRID: AB_2281134 , IF (1:500) WB (1:1000).

Techniques: Control, Isolation, Derivative Assay, Purification, Comparison

( A ) Whole cell lysates (WCL) and isolated EVs from wild-type (WT) mouse embryonic fibroblast (MEF) cells treated with 10 µM GW4869 or 10 nM bafilomycin-A1 (B-A1) for 24 hr were analyzed by immunoblotting. Representative immunoblots of LAMP2, Flotillin-1, and α-Tubulin are shown. Molecular weight marker mobility is shown in kDa. Ultra-performance liquid chromatography–tandem mass spectrometry (UPLC–MS/MS) determination of EV-associated di-18:1-BMP normalized to protein content from WT MEF cells treated with 10 µM GW4869 ( B ) or 10 nM B-A1 ( C ) for 24 hr. Data shown as fold change relative to WT control MEF cells. Only BMP isoforms that were detected are shown. Data from 6 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Quantitation of BMP isoforms normalized to protein content in WCL from MEF WT cells treated with 10 µM GW4869 ( D ) or 10 nM B-A1 ( E ) for 24 hr. Data shown as fold change relative to WT control MEF cells. Only BMP isoforms that were detected are shown. Data from 3 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test; *p < 0.05, **p < 0.01, ***p < 0.001. Figure 6—source data 1. Uncropped blots. Figure 6—source data 2. Annotated uncropped blots. Figure 6—source data 3. Plotted values in panels B–E.

Journal: eLife

Article Title: Extracellular vesicle-mediated release of bis(monoacylglycerol)phosphate is regulated by LRRK2 and glucocerebrosidase activity

doi: 10.7554/eLife.106330

Figure Lengend Snippet: ( A ) Whole cell lysates (WCL) and isolated EVs from wild-type (WT) mouse embryonic fibroblast (MEF) cells treated with 10 µM GW4869 or 10 nM bafilomycin-A1 (B-A1) for 24 hr were analyzed by immunoblotting. Representative immunoblots of LAMP2, Flotillin-1, and α-Tubulin are shown. Molecular weight marker mobility is shown in kDa. Ultra-performance liquid chromatography–tandem mass spectrometry (UPLC–MS/MS) determination of EV-associated di-18:1-BMP normalized to protein content from WT MEF cells treated with 10 µM GW4869 ( B ) or 10 nM B-A1 ( C ) for 24 hr. Data shown as fold change relative to WT control MEF cells. Only BMP isoforms that were detected are shown. Data from 6 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Quantitation of BMP isoforms normalized to protein content in WCL from MEF WT cells treated with 10 µM GW4869 ( D ) or 10 nM B-A1 ( E ) for 24 hr. Data shown as fold change relative to WT control MEF cells. Only BMP isoforms that were detected are shown. Data from 3 independent experiments (mean ± SEM). Significance determined by two-tailed unpaired t -test; *p < 0.05, **p < 0.01, ***p < 0.001. Figure 6—source data 1. Uncropped blots. Figure 6—source data 2. Annotated uncropped blots. Figure 6—source data 3. Plotted values in panels B–E.

Article Snippet: Antibody , anti-mouse LAMP2, clone GL2A7 (Rat monoclonal) , Developmental Studies Hybridoma Bank , GL2A7; RRID: AB_2281134 , IF (1:500) WB (1:1000).

Techniques: Isolation, Western Blot, Molecular Weight, Marker, Liquid Chromatography, Mass Spectrometry, Tandem Mass Spectroscopy, Control, Two Tailed Test, Quantitation Assay

Whole cell lysates (WCL) and isolated EVs from R1441G LRRK2 MEF cells treated with 10 µM GW4869 or 10 nM bafilomycin-A1 for 24 h were analyzed by immunoblotting. Representative images of LAMP2, Flotillin-1, and α-Tubulin levels are shown. Molecular weight marker mobility is shown in kDa. Figure 6—figure supplement 1—source data 1. Uncropped blots. Figure 6—figure supplement 1—source data 2. Annotated uncropped blots.

Journal: eLife

Article Title: Extracellular vesicle-mediated release of bis(monoacylglycerol)phosphate is regulated by LRRK2 and glucocerebrosidase activity

doi: 10.7554/eLife.106330

Figure Lengend Snippet: Whole cell lysates (WCL) and isolated EVs from R1441G LRRK2 MEF cells treated with 10 µM GW4869 or 10 nM bafilomycin-A1 for 24 h were analyzed by immunoblotting. Representative images of LAMP2, Flotillin-1, and α-Tubulin levels are shown. Molecular weight marker mobility is shown in kDa. Figure 6—figure supplement 1—source data 1. Uncropped blots. Figure 6—figure supplement 1—source data 2. Annotated uncropped blots.

Article Snippet: Antibody , anti-mouse LAMP2, clone GL2A7 (Rat monoclonal) , Developmental Studies Hybridoma Bank , GL2A7; RRID: AB_2281134 , IF (1:500) WB (1:1000).

Techniques: Isolation, Western Blot, Molecular Weight, Marker

(A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Journal: Cell reports

Article Title: Aging disrupts sympathetic innervation of the thymus

doi: 10.1016/j.celrep.2026.117126

Figure Lengend Snippet: (A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Article Snippet: qPCR Primer – Lamp2 FW: GAGCAGGTGCTTTCTGTGTCTAG Rev: GCCTGAAAGACCAGCACCAACT , Origene , SKU: MP222524.

Techniques: Labeling, MANN-WHITNEY

Mouse femur section was co-stained with anti-CtsK (green), HS20 (purple) and anti-LAMP2 (red) and visualized with anti-rabbit Alexa488, anti-human Alexa594, and anti-rat Alexa647 secondary antibodies, respectively. Area shown is the cortical bone. The approximate boundary of the bone is shown with white dashed line. A blood vessel within the bone is indicated with yellow dashed line. Red blood cells in the vessel shown strong green autofluorescence. A closeup view of the large osteoclast is shown in the right bottom panel. Another osteoclast (likely only the tip of the osteoclast) is indicated with a yellow arrow in the merged image. Nuclei of several osteocytes are indicated with white arrow head. Images representative of three separate experiments.

Journal: bioRxiv

Article Title: Heparan sulfate promotes autoactivation of pro-Cathepsin K by destabilizing the propeptide-catalytic domain interaction

doi: 10.64898/2026.01.18.700217

Figure Lengend Snippet: Mouse femur section was co-stained with anti-CtsK (green), HS20 (purple) and anti-LAMP2 (red) and visualized with anti-rabbit Alexa488, anti-human Alexa594, and anti-rat Alexa647 secondary antibodies, respectively. Area shown is the cortical bone. The approximate boundary of the bone is shown with white dashed line. A blood vessel within the bone is indicated with yellow dashed line. Red blood cells in the vessel shown strong green autofluorescence. A closeup view of the large osteoclast is shown in the right bottom panel. Another osteoclast (likely only the tip of the osteoclast) is indicated with a yellow arrow in the merged image. Nuclei of several osteocytes are indicated with white arrow head. Images representative of three separate experiments.

Article Snippet: Following deparaffinization and citric acid-based antigen retrieval (pH7), sectioned were blocked and incubated overnight at 4 °C with the following primary antibodies: 0.2 μg/ml rabbit anti-mCtsK polyclonal antibody (described previously) , 1ug/ml human anti-HS mAb (HS20, from Bio X cell) , and 1ug/ml Rat anti-mouse Lamp2 (GL2A7, Developmental Studies Hybridoma Bank).

Techniques: Staining